Rolling circle–based linear amplification
WebAug 1, 2024 · Here, we present an isothermal strategy named rolling circle reverse transcription-mediated RNA amplification (RCRT-MRA) to amplify small RNAs with accurate length and sequence. The target RNA and complementary DNA were circularized to serve as amplicons replicated via the rolling circle mechanism. WebOct 1, 2024 · Rolling circle amplification (RCA) is a simple and isothermal DNA amplification technique that is used to generate thousands of repeating DNA sequences …
Rolling circle–based linear amplification
Did you know?
WebJul 24, 2024 · An exonucleolytic digestion-assisted exponential rolling circle amplification (RCA) strategy was developed for sensitive and sequence-specific detection of target DNA embedded in... WebMay 13, 2024 · Rolling circle amplification(RCA) is an isothermal nucleic acid amplification method, initially found in bacteriophage. By employing certain DNA polymerase with chain replace- ment...
WebJun 24, 2024 · Based on time-cost analysis and comparative activity data, a cell-free workflow using synthetic DNA minicircles and rolling circle amplification enables … WebLncRNA detection based on multi-probes induced rolling circle amplification for hepatocellular carcinoma early diagnosis Yanheng Yaoa, Chengjie Duana, Yan Chena, Zhiqiang Houa, Wenting Chenga, Dayong ... Linear DNA PO43-CATACCTCC AAT TTCCCACTGATGCTCTTAAT GATTG ATCACCGGT
WebJan 8, 2015 · Rolling circle amplification is an isothermal method for amplifying DNA. The technique rapidly synthesizes a long (more than 1000 bases), linear, tandemly-repetitive … WebNov 16, 2009 · The padlock-probes and rolling-circle amplification technology is a simple, sensitive, and reliable miRNA expression detection protocol. A padlock-probe is a linear DNA probe where the two terminal aims are designed to be exactly antisense to the 5’-end and 3’-end sequences of a target miRNA of interest. Rolling circle amplification allows ...
WebLau HY, Botella JR (2024) Advanced DNA-based point of care diagnostic methods for plant diseases detection. Plant Sci 8:2016 Lizardi PM, Huang XH, Zhu ZR, Bray-Ward P, Thomas DC, Ward DC (1998) Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nat Genet 19:225–232
WebA toehold mediated feedback rolling circle amplification with exponential signal amplification enables label-free nucleic acid sensing with high sensitivity and specificity. Author links open overlay panel Ting Huang a 1, Daozhong Zhu a b 1, Tong Li a, Mengxu Sun a, Guixun Chen a, Yanxin Zhang a, Jin-Xiang Chen a, Xiaoyong Zou d, Zong Dai c ... puzzle online plWebAug 6, 2024 · Padlock probe ligation-based rolling circle amplification (RCA) can distinguish single-nucleotide variants, which is promising for the detection of drug-resistance mutations in, e.g., Mycobacterium tuberculosis ( Mtb ). domaci pilici prodajaWebHerein, we proposed a highly loaded Na +-fueled linear programmable DNAzyme nanostructure (LPDN) composed of long, single-strand DNA produced by rolling circle amplification reactions that served as binding partners for Na +-specific DNAyme and substrate. In the meantime, the long, programmable scaffolds can precisely control the … puzzle oski djecoWebMar 1, 2024 · Rolling circle amplification (RCA) is an efficient enzymatic isothermal reaction that using circular probe as a template to generate long tandem single-stranded DNA or RNA products under the initiation of short DNA or RNA primers. Thus, in this study, using STAT3 gene as the model molecule, we developed a novel … Rolling circle amplification DNA replication not only uses linear DNA, but can also … Rolling circle amplification (RCA) is an elegant and well-recognized isothermal … Thrombin, as a model analyte, plays a central role in thrombosis, involved in the … Detection of specific genes related to drug action can provide scientific guidance for … Herein, we report rolling-circle amplification (RCA) based single-color QDs–Ru … puzzle online kraina lodu 2WebDec 1, 2001 · Rolling circle amplification (RCA) is a technology that is adaptable to an on-chip signal amplification format. In RCA, a circle of DNA, a short DNA primer (complementary to a portion of the circle) and an enzyme catalyst converts dNTPs into a single-stranded concatameric DNA molecule that is composed of thousands of tandemly … domaci pilingdomaci pilici na prodajuWebRolling circle replication ( RCR) is a process of unidirectional nucleic acid replication that can rapidly synthesize multiple copies of circular molecules of DNA or RNA, such as … domaci pilici za prodaju